akt mutant plasmid  (Addgene inc)

Journal: The FEBS journal

Article Title: A liquid culture cancer spheroid model reveals low PI3K/Akt pathway activity and low adhesiveness to the extracellular matrix.

doi: 10.1111/febs.15867

Figure Lengend Snippet: Fig. 4. The requirement of PI3K/Akt pathway for pERM expression on the spheroid surface. MCF7 cells were cultured with LA717 for 7–8 days in the presence of chemicals (A–C, PI3K modulators; E–G, Akt modulators) or for 6 days after the transfection of DNAs (I–K, Akt1 mutants) as indicated on the top of each panel and stained for pERM (green), b1-integrin (red) and nucleus (blue). Akt1 T308A;S473A (shown as Akt-A in (L)) is an inactive form, whereas T308D;S473D (Akt-D in (L)) is a constitutively active form. Arrows show protruding cells with convex appearance. Scale bars, 20 lm. (D, H, L) Quantification of pERM staining intensity as explained in the Fig. S1. Light grey in the bar charts indicates weak staining surface area in a percentage ratio to the whole surface area on the image, whereas dark grey shows strongly stained area. n = 22–26 in (D) and (H); n = 60 (control), 76 (Akt-A), 45 (Akt-D) in (L). Following ANOVA, post hoc analysis was conducted by Student’s t-test. *P < 0.05; **P < 0.01; ***P < 0.001 compared with the control.

Article Snippet: Akt1 T308A;S473A was a gift from William Sellers (Addgene plasmid # 9030; http://n2t.net/addgene:9030; RRID:Addgene_9030) [58].

Techniques: Expressing, Cell Culture, Transfection, Staining, Control

Journal: Developmental cell

Article Title: SH3BP4 promotes neuropilin-1 and α5-integrin endocytosis and is inhibited by Akt.

doi: 10.1016/j.devcel.2021.03.009

Figure Lengend Snippet: Figure 2. SH3BP4 targeting to CCPs is blocked by 14-3-3 (A) Immunoprecipitation (IP) of SH3BP4-GFP wt and S246A/D mutants for endogenous 14-3-3ε (N = 6 experiments, representative data). (B) IP of SH3BP4-GFP wt and R18 mutants for endogenous 14-3-3ε (N = 4). (C) Total internal reflection fluorescence microscopy of SH3BP4-GFP wt and R18 mutants co-expressed with tdTomata-Clca. Scale bar 5 mm. (D) Percentage of SH3BP4-GFP-positive CCPs for SH3BP4-GFP wt and R18 mutants (N = 3, n = 42 cells each). For statistical analysis, rank-sum test was used, data presented as box and whisker plots, ns, not significant, **p < 0.01, ****p < 0.0001. (E) IP of SH3BP4-GFP for endogenous 14-3-3ε with Akt1-wt-HA overexpression (OX) (N = 5). (F) IP of 14-3-3b-GFP for HA-SH3BP4 with Akt1-wt-HA OX (N = 5). For the IP experiments, representative data are shown and statistics of IP data are in Figure S2.

Article Snippet: For transient overexpression of Akt1-wt-HA, DNA was amplified (DNA from 896 pcDNA3 T7 Akt1 was a gift from William Sellers, Addgene plasmid # 9003; http://n2t.net/addgene:9003; RRID:Addgene_9003) with a reverse primer to insert a HA tag and subcloned into pcDNA 3.1 using EcoRI and XhoI (NEB) as described above.

Techniques: Immunoprecipitation, Microscopy, Whisker Assay, Over Expression

Journal: Journal of Virology

Article Title: Specific Akt Family Members Impair Stress-Mediated Transactivation of Viral Promoters and Enhance Neuronal Differentiation: Important Functions for Maintaining Latency

doi: 10.1128/jvi.00901-20

Figure Lengend Snippet: Figure 2. Akt1 and Akt2 impair GR mediated activation of MMTV-LTR promoter. 693

Article Snippet: 154 Akt1 is a serine/threonine protein kinase, and the Akt1 kinase dead mutant (Addgene, 1014 155 pcDNA3 T7, that contains 3 point mutations; K179M, T308A and S473A) (56) was used to 156 test whether kinase activity was important for inhibiting GR-mediated transcription.

Techniques: Activation Assay

Journal: Journal of Virology

Article Title: Specific Akt Family Members Impair Stress-Mediated Transactivation of Viral Promoters and Enhance Neuronal Differentiation: Important Functions for Maintaining Latency

doi: 10.1128/JVI.00901-20

Figure Lengend Snippet: Akt family members influence GR- and DEX-mediated transactivation of the IEtu1 collapsed promoter. (A) Neuro-2A cells were transfected with the IEtu1 collapsed promoter construct containing the firefly luciferase reporter gene (0.5 μg) and, where indicated, plasmids that expressed GR (1.0 μg), Akt1, Akt2, or Akt3 (1.0 μg). (B) Neuro-2A cells were transfected with the IEtu1 collapsed promoter (0.5 μg) and, where indicated, plasmids that expressed GR (1.0 μg), Akt1 (1.0 μg, 2.0 μg, or 3.0 μg). or Akt1 kinase mutant construct (3.0 μg). All transfections contained a plasmid that expresses Renilla luciferase (0.05 μg) to normalize firefly luciferase values. To maintain the same amount of DNA in each sample, empty vector was included in certain samples. Cells were incubated with 2% stripped fetal bovine serum (FBS) at approximately 24 h after transfection, and then certain cultures were treated with DEX (10 μM). At 48 h after transfection, cells were harvested and protein lysate subjected to a dual-luciferase assay. The results are the average of 3 independent experiments, and error bars denote the standard error. Student’s t test was used for statistical analysis. ns, not significant; **, P < 0.01; ***, P < 0.001.

Article Snippet: The Akt1 kinase dead mutant (1014 pcDNA3 T7; Addgene) includes 3 points mutations, K179M, T308A, and S473A.

Techniques: Transfection, Construct, Luciferase, Mutagenesis, Plasmid Preparation, Incubation

Journal: Journal of Virology

Article Title: Specific Akt Family Members Impair Stress-Mediated Transactivation of Viral Promoters and Enhance Neuronal Differentiation: Important Functions for Maintaining Latency

doi: 10.1128/JVI.00901-20

Figure Lengend Snippet: Akt1 and Akt2 impair GR-mediated activation of the MMTV-LTR promoter. (A) Neuro-2A cells were transfected with the MMTV-LTR promoter construct (0.5 μg) and, where indicated, plasmids that express GR (1.0 μg), Akt1, Akt2, or Akt3 (1.0 μg). (B) Neuro-2A cells were transfected with the MMTV-LTR promoter construct (0.5 μg) and, where indicated, plasmids that expressed GR (1.0 μg), Akt1 (1.0 μg, 2.0 μg, or 3.0 μg), or Akt1 kinase mutant construct (3.0 μg). All transfections contained a plasmid that expresses Renilla luciferase (0.05 μg) to normalize firefly luciferase values. To maintain the same amount of DNA in each sample, empty vector was included in certain samples. Cells were incubated with 2% stripped FBS at approximately 24 h after transfection and then certain cultures were treated with DEX (10 μM). At 48 h after transfection, cells were harvested and protein lysate subjected to a dual-luciferase assay. The results are the average of 3 independent experiments and error bars denote the standard error. Student’s t test was used for statistical analysis. ns, not significant; **, P < 0.01; ***, P < 0.001.

Article Snippet: The Akt1 kinase dead mutant (1014 pcDNA3 T7; Addgene) includes 3 points mutations, K179M, T308A, and S473A.

Techniques: Activation Assay, Transfection, Construct, Mutagenesis, Plasmid Preparation, Luciferase, Incubation

Journal: Journal of Virology

Article Title: Specific Akt Family Members Impair Stress-Mediated Transactivation of Viral Promoters and Enhance Neuronal Differentiation: Important Functions for Maintaining Latency

doi: 10.1128/JVI.00901-20

Figure Lengend Snippet: Akt1 significantly reduces GR- and KLF15-mediated transactivation of the HSV-1 ICP0 promoter. (A) Neuro-2A cells were transfected with the HSV-1 ICP0 promoter construct (0.5 μg), plasmids that express Akt1 or Akt1m (1.0 μg), and a plasmid that expresses GR (1.0 μg). (B) Neuro-2A cells were transfected with the ICP0 promoter construct (0.5 μg) and, where indicated, plasmids that expressed GR (1.0 μg), KLF15 (1.0 μg), Akt1 (1.0 μg, 2.0 μg, or 3.0 μg), or Akt1 kinase mutant construct (3.0 μg). All transfections contained a plasmid that expresses Renilla luciferase (0.05 μg) to normalize firefly luciferase values. To maintain the same amount of DNA in each sample, empty vector was included in certain samples. Cells were incubated with 2% stripped FBS 24 h after transfection and then certain cultures were treated with DEX (10 μM). At 48 h after transfection, cells were harvested and protein lysate subjected to a dual-luciferase assay. The results are the average of 3 independent experiments, and error bars denote the standard error. Student’s t test was used for statistical analysis. ns, not significant; **, P < 0.01; ***, P < 0.001. (C) Neuro-2A cells were transfected with a plasmid that expresses Akt1 (1.0, 2.0 or 3.0 μg of the expression vector as denoted), and a plasmid that expresses GR (1.0 μg). Cells were incubated with 2% stripped FBS 24 h after transfection and then certain cultures were treated with DEX (10 μM). At 48 h after transfection, cells were harvested, cell lysate prepared, and Western blot analysis performed to detect GR and the loading control, glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Fifty μg of protein was loaded in each lane. The results are the average of 3 independent experiments. kd, kilodalton.

Article Snippet: The Akt1 kinase dead mutant (1014 pcDNA3 T7; Addgene) includes 3 points mutations, K179M, T308A, and S473A.

Techniques: Transfection, Construct, Plasmid Preparation, Mutagenesis, Luciferase, Incubation, Expressing, Western Blot, Control

Journal: Journal of Virology

Article Title: Specific Akt Family Members Impair Stress-Mediated Transactivation of Viral Promoters and Enhance Neuronal Differentiation: Important Functions for Maintaining Latency

doi: 10.1128/JVI.00901-20

Figure Lengend Snippet: Akt3 efficiently promotes neurite formation in Neuro-2A cells. Neuro-2A cells were cotransfected with an empty vector (pcDNA3.1) (A), a plasmid expressing Akt1 or Akt2 (Panel B), or Akt3 (C and D) (1 μg plasmid DNA) and a plasmid expressing the lacZ gene (0.1 μg plasmid) to mark transfected cells. (B) A typical result from cells transfected with Akt1 or Akt2. To induce neurite sprouting, 24 h after transfection, cells were seeded into new plates at a low density (2,000 cells/cm2) and then incubated with minimal essential medium (MEM) that contained 0.5% serum for 3 days. Cells were fixed, and β-Gal+ cells were detected by staining.

Article Snippet: The Akt1 kinase dead mutant (1014 pcDNA3 T7; Addgene) includes 3 points mutations, K179M, T308A, and S473A.

Techniques: Plasmid Preparation, Expressing, Transfection, Incubation, Staining

Journal: Molecular and Cellular Biology

Article Title: AKT Regulates Mitotic Progression of Mammalian Cells by Phosphorylating MASTL, Leading to Protein Phosphatase 2A Inactivation

doi: 10.1128/MCB.00366-18

Figure Lengend Snippet: AKT-mediated phosphorylation on MASTL increases CDK1 substrate phosphorylation. (A) pCMV-HA-MASTL (2 μg) was cotransfected with pCDNA3.1-HA-AKT (1 μg) into HEK 293T cells, and pEGFP-F (1 μg) was used as a transfection control. At 24 h posttransfection, cells were arrested in mitosis by use of 50 nM nocodazole for 18 h. Western blotting showed a band shift of HA-MASTL in the presence of HA-AKT (indicated by the arrow). (B) Increasing amounts of pCDNA3.1-HA-AKT were cotransfected with pCMV-HA-MASTL (2 μg) into 293T cells. The blot shows increasing phosphorylation of MASTL as well as other CDK substrates in the presence of increasing amounts of HA-AKT. Phosphorylation levels of Aurora kinase (pAur) were used as mitotic markers. For blots below the dashed line, the same lysates as those above the line were loaded again and run on a separate gel. (D) Western blot showing CDK-mediated phosphorylation of mutant MASTL (mutMASTL) or other CDK substrates in the presence of increasing amounts of HA-AKT. (F) An antibody against phospho-CDK1-T14 (pThr14) was used to determine PP2A activity in the presence of the cotransfected constructs HA-MASTL (2 μg) and HA-AKT1 (in increasing amounts [0.25, 0.5. 0.75, 1.0, and 1.5 μg in the second to sixth lanes, respectively]). The amounts of transfected HA-AKT were detected using an anti-AKT antibody, while MASTL was detected with an anti-MASTL antibody. (G) Blot showing CDK1 substrate phosphorylation levels in the presence of wild-type HA-MASTL (2 μg) and increasing amounts of pKH3-RSK1. (C, E, and H) Quantification of the anti-pSer-CDK1 substrate signal intensities in panels B, D, and G, respectively. The amounts of transfected plasmids used in panels B, D, and G are given in panels C, E, and H, respectively. The experiments were repeated three times. Data are expressed as means ± standard errors of the means of triplicates.

Article Snippet: Other plasmids used were pCDNA3.1 HA-AKT1 (Addgene plasmid 9008) ( 50 ), human PKH3-RSK1 (Addgene plasmid 13841) ( 52 ), the AKT kinase-dead construct pCDNA3 T7 AKT1 K179M T308A S473A (Addgene plasmid 9031) ( 50 ), pCMV-FLAG-hErk1 (Addgene plasmid 49328), pCDNA3-FLAG-p38α (Addgene plasmid 20351), pCDNA3/FLAG-FOXO1, and pWZL-Neo-Myr-FLAG-AKT (Addgene plasmid 20422). pEGFP-F (Clontech) was used as a transfection control. pCDNA3-FLAG-FOXO1 (also known as FKHR) was a kind gift from Kunliang Guan ( 51 ). pBABE-puro-HA-PIK3CA (H1047R) ( 28 ) and the 293T, Phoenix, and SW480 cell lines were kindly given as gifts by Thomas Roberts, Dana-Farber Cancer Institute, Harvard University, USA. shAKT1 and shAKT2 were cloned into pLKO.1 puro using the CGCGTGACCATGAACGAGTTT sequence for shAKT1 and the CGAGTTTGAGTACCTGAAGCT sequence for shAKT2 ( 53 ).

Techniques: Transfection, Western Blot, Electrophoretic Mobility Shift Assay, Mutagenesis, Activity Assay, Construct